To date, the only species of leech reported from the American Alligator, Alligator mississippiensis is Placobdella multilineata. Seven specimens of a previously undescribed species of Placobdella were collected from the feet and lower jaw of a single female alligator from the Pascagoula River Wildlife Management Area, George County, Mississippi. The new species was named Placobdella siddalli Richardson & Moser, sp. n., in honor of the contributions of Dr. Mark Siddall to our understanding of the biology of leeches. Placobdella siddalli Richardson & Moser is similar to other papillated members of the genus Placobdella, but differs from Placobdella ali Hughes & Siddall, 2007, Placobdella rugosa (Verrill, 1874), Placobdella multilineata Moore, 1953, and Placobdella papillifera (Verrill, 1872) in coloration, papillation, ventral striping, and in the possession of a relatively large caudal sucker. In addition, molecular comparison of 626 nucleotides of CO-I between the new species and other papillated leeches (P. ali, P. multilineata, Placobdella ornata, P. papillifera, P. rugosa) revealed interspecific differences of 14.0–18.0% (88–113 nucleotides).

Placobdella siddalli , Alligator mississippiensis , American Alligator, Glossiphoniidae , Hirudinea , Clitellata

There are 22 recognized species of Glossiphoniid leeches in the genus Placobdella parasitizing birds, mammals, amphibians and reptiles (Moser et al. 2014). To date, the only species of leech reported from the American Alligator, Alligator mississippiensis (Daudin, 1802) Cuvier, 1807 is Placobdella multilineata Moore, 1953. Placobdella multilineata is a generalist parasite of reptiles having been reported from turtles, snakes, and alligators from throughout the southeastern United States and Mississippi River Valley as far north as Illinois and Iowa (Klemm 1985; Moser et al. 2014). In addition, Saumure and Doody (1998) reported two specimens of P. multilineata from a three-toe Amphiuma, Amphiuma tridactylum Cuvier, 1827 from Louisiana. In the course of a routine parasitological survey of blood parasites of Mississippi alligators, seven specimens of a previously undescribed species of Placobdella were collected and are described herein.

On 9 August 2015, seven specimens of a previously undescribed species of Placobdella were collected from the feet and lower jaw of a single female Mississippi alligator, approximately 1.2 m long, that was pole snared from Davis Eddy, a cypress swamp constituting an oxbow lake of the Pascagoula River in the Pascagoula River Wildlife Management Area, George County, Mississippi (30°54'11"N, 088°44'35"W). Six additional alligators examined from the same region were leech-free.

Leeches were relaxed, fixed and examined as described by Moser et al. (2006). Terminology for plane shapes follows Clopton (2004). Ranges are given followed by mean in parentheses. One specimen was mounted in Canada balsam following the techniques of Richardson and Barger (2006). Specimens were deposited in the Invertebrate Zoology Collection of the Peabody Museum of Natural History, Yale University, New Haven, Connecticut, USA (YPM) and the Smithsonian Institution, National Museum of Natural History, Washington, District of Columbia, USA (USNM). The following specimens held in the collection of the Peabody Museum of Natural History, Yale University, New Haven Connecticut were examined in comparison to Placobdella siddalli Richardson & Moser, and caudal sucker diameter relative to body width and length was determined: Placobdella ali Hughes & Siddall, 2007 (YPM 047497, N = 1; YPM 058254, N = 1; and YPM 058279, N = 1), P. multilineata (YPM 083513, N = 8), Placobdella ornata (Verrill, 1827) Moore, 1901 (YPM 048007, N = 1; YPM 058351, N = 3, YPM 058360, N = 1; YPM 058371, N = 1; YPM 058551, N = 1; and YPM 058322, N = 2), Placobdella papillifera (Verrill, 1872) Moore, 1952 (YPM 043493, N = 1; YPM 043494, N = 7; and YPM 043557, N = 3), Placobdella parasitica (Say, 1824) Moore 1901 (YPM 053088, N = 1; YPM 058096, N = 1; YPM 058091, N = 1; YPM 058092, N = 1; YPM 058093, N = 1; and YPM 058094, N = 1), and Placobdella rugosa (Verrill, 1874) Moore, 1901 (YPM 056679, N = 1; YPM 056680, N = 2; YPM 056681, N = 1; and YPM 058081, N = 2).

Molecular analyses were conducted according to Richardson et al. (2010) as follows: For the proteinase K treatment step, tissue samples were taken from the caudal suckers of individual leeches and lysed overnight at 56^oC. DNA was isolated with the DNeasy Blood & Tissue Kit from Qiagen (Cat. No. 69504), following the protocol given for the purification of total DNA from animal tissues (spin-column). DNA was eluted from the spin columns with 100 µl of buffer.

Polymerase Chain Reactions (PCR) were prepared using the Illustra PuRe Taq Ready-To-Go PCR beads from GE Health Care (Cat. No. 27-9559-01). Primers were purchased from Invitrogen and were comprised of two primers each for mitochondrial cytochrome c oxidase subunit I (CO-I) as specified by Light and Siddall (1999). Specifically, the CO-I primers were LCO1490 (5’GGTCAACAAATCATAAAGATATTGG 3’) and HCO2198 (5’TAAACTTCAGGGTGACCAAAAAATCA 3’). Final volume of PCR reactions was 25 µl with three µl of leech genomic DNA added per reaction. DNA was amplified under the following PCR conditions: 94^oC for five min.; 35 cycles of (94^oC for 30 sec, 50^oC for 30 sec, 72^oC for 45 sec); 72^oC for seven min. Following PCR, samples were cleaned up using a QIAquick PCR purification kit from Qiagen (Cat. No. 28104).

Purified PCR products were sequenced using the HCO2198 primer for the cytochrome c oxidase subunit I gene by the W. M. Keck Foundation Biotechnology Resource Laboratory at Yale University. The DNA sequences were aligned using Clustal W version 2 (Larkin et al. 2007) and checked manually using SeaView 4 (Gouy et al. 2010) and then analyzed using PAUP* 4.0b10 (Swofford 2002) and compared to other leech DNA sequences contained within Genbank. Uncorrected p distances were calculated using PAUP*.

Placobdella siddalli Richardson & Moser most closely resembles P. multilineata, P. ali, and P. rugosa. Both P. ali and P. rugosa have faint but distinct brown pigmented lines corresponding to paralateral and paramedial papillae, that are lacking in P. siddalliRichardson & Moser. In P. ali, the dorso-medial line is unbroken, whereas it is broken in P. siddalli Richardson & Moser. Also P. ali, P. multilineata, P. ornata, and P. rugosa, have a medial row of small but distinct papillae, each lying between the anus and four prominent paramedial papillae (Fig. 4). Probably because of their diminutive size, these papillae have not previously been described although they are evident in Fig. 2 of Moser, Richardson, Hammond, and Lazo-Wasem (2012) and Fig. 3 of Moser, Richardson, Hammond, Govedich, and Lazo-Wasem (2012). These papillae are lacking in P. siddalli Richardson & Moser and P. papillifera (Fig. 5). Placobdella ali also exhibits ventral striping that is lacking in P. siddalli Richardson & Moser.

The relative diameter of the caudal sucker in comparison to body width and body length was found to be helpful in differentiating species of the genus Placobdella (Fig. 6). Table 1 gives relative size of the caudal suckers in comparison to body width and length for P. ali, P. siddalli Richardson & Moser, P. multilineata, P. ornata, P. papillifera, P. parasitica, and P. rugosa. The caudal sucker diameter of P. siddalli Richardson & Moser is 18% to 23% of the length of the body. This relative diameter is similar to that of P. rugosa and P. papillifera, but is greater than that of P. ali and P. multilineata, with the caudal sucker diameter to body-length ratio not overlapping. Likewise the diameter to body-length ratio of the caudal sucker of P. siddalli Richardson & Moser is larger than that of P. ornata and P. parasitica, overlapping only slightly. The caudal sucker diameter of P. siddalli Richardson & Moser is 40% to 54% of the width of the body. This relative diameter is greater than that of P. ali and P. ornata, with the caudal sucker diameter to body-width ratio not overlapping.

The unique color patterning, papillation and large relative size of the caudal sucker renders P. siddalli Richardson & Moser readily discernible from all described species in the genus Placobdella. It is likely that further collection, and retrospective examination of museum holdings, of the papillated Placobdella will provide additional information on the distribution and host utilization patterns of this intriguing new species.

In the course of this study, two new taxonomic characters have been utilized for differentiation of species within the genus Placobdella: the presence or absence of a medial row of small but distinct papillae lying between the anus and 4 prominent paramedial papillae and the ratio of sucker diameter to body length and width. These characters may help provide resolution between other species in the genus Placobdella, as well as species representing other genera.